home *** CD-ROM | disk | FTP | other *** search
mmmmppppccccoooonnnnffff((((3333cccc)))) mmmmppppccccoooonnnnffff((((3333cccc)))) NNNNAAAAMMMMEEEE mmmmppppccccoooonnnnffff - multiprocessing control and information SSSSYYYYNNNNOOOOPPPPSSSSIIIISSSS ####iiiinnnncccclllluuuuddddeeee <<<<ssssyyyyssss////mmmmppppccccoooonnnnffff....hhhh>>>> ####iiiinnnncccclllluuuuddddeeee <<<<ssssyyyyssss////ssssyyyyssssiiiinnnnffffoooo....hhhh>>>> iiiinnnntttt mmmmppppccccoooonnnnffff ((((iiiinnnntttt ccccmmmmdddd,,,, ............))));;;; DDDDEEEESSSSCCCCRRRRIIIIPPPPTTTTIIIIOOOONNNN _mmmm_pppp_cccc_oooo_nnnn_ffff provides control/information for miscellaneous multi-processor services. The arguments _a_r_g_1, _a_r_g_2, _a_r_g_3 are provided for command- dependent use. As specified by _c_m_d, the following commands are available: ____MMMMIIIIPPPPSSSS____MMMMPPPP____NNNNPPPPRRRROOOOCCCCEEEESSSSSSSSOOOORRRRSSSS Returns the number of processors physically configured. ____MMMMIIIIPPPPSSSS____MMMMPPPP____NNNNAAAAPPPPRRRROOOOCCCCEEEESSSSSSSSOOOORRRRSSSS Returns the number of processors that are available to schedule unrestricted processes. ____MMMMIIIIPPPPSSSS____MMMMPPPP____IIIISSSSPPPPRRRROOOOCCCCEEEESSSSSSSSOOOORRRR____AAAAVVVVAAAAIIIILLLL The processor number given by _a_r_g_1, interpreted as an 'int', is checked to see if it is available and not exclusively bound by any process and if this is true a value of _o_n_e(_1) is returned. If the processor is not available, a value of _z_e_r_o(_0) is returned. ____MMMMIIIIPPPPSSSS____MMMMPPPP____PPPPRRRROOOOCCCCEEEESSSSSSSSOOOORRRR____AAAACCCCCCCCTTTT Returns the contents of _a_b_i__s_y_s_i_n_f_o structure. The information is only for the processor specified by _a_r_g_1. _a_r_g_2 points to a buffer which will contain the contents of the structure _a_b_i__s_y_s_i_n_f_o in the address space of the calling process and _a_r_g_3 specifies the maximum number of bytes to transfer. If successful, the command returns the number of bytes transferred. ____MMMMIIIIPPPPSSSS____MMMMPPPP____PPPPRRRROOOOCCCCEEEESSSSSSSSOOOORRRR____TTTTOOOOTTTTAAAACCCCCCCCTTTT Returns the contents of the _a_b_i__s_y_s_i_n_f_o structure. The information is summed across all processors before it is returned. _a_r_g_1 points to a buffer which will contain the contents of the structure _a_b_i__s_y_s_i_n_f_o and _a_r_g_2 specifies the maximum number of bytes to transfer. If successful, the command returns the number of bytes transferred. ____MMMMIIIIPPPPSSSS____MMMMPPPP____PPPPRRRROOOOCCCCEEEESSSSSSSSOOOORRRR____PPPPIIIIDDDD If the process number specified in _a_r_g_1, interpreted as 'pid_t', is bound to a processor, then _o_n_e(_1) is returned and the integer pointer in _a_r_g_2, interpreted as 'int *', is used to store the processor number to which the process is bound. There is no indication whether the binding in effect is exclusive or non- exclusive. The command returns _z_e_r_o(_0) if the process is not bound. PPPPaaaaggggeeee 1111 mmmmppppccccoooonnnnffff((((3333cccc)))) mmmmppppccccoooonnnnffff((((3333cccc)))) If _a_r_g_1 contains an invalid process number, then a -_1 is returned and _e_r_r_n_o is set to reflect the error. ____MMMMIIIIPPPPSSSS____MMMMPPPP____PPPPRRRROOOOCCCCEEEESSSSSSSSOOOORRRR____BBBBIIIINNNNDDDD Bind a process number pointed to _a_r_g_2, interpreted as 'pid_t *', to the processor number in _a_r_g_1, interpreted as 'int'. The process is restricted to run only on this processor. The processor may continue to run other processes. Note that the process may still run on other processors, briefly, to perform I/O or other hardware- specific actions. If a previous binding was in effect for the process number pointed to by _a_r_g_2, and the binding was not exclusive, then new binding replaces the previous one. If the previous binding was exclusive, the command fails. If a previous exclusive binding is in effect for this processor, it is unavailable to be reserved, and the command fails. The command returns a _z_e_r_o(_0) when successful. ____MMMMIIIIPPPPSSSS____MMMMPPPP____PPPPRRRROOOOCCCCEEEESSSSSSSSOOOORRRR____UUUUNNNNBBBBIIIINNNNDDDD Unbind a process number pointed to by _a_r_g_1, interpreted as 'pid_t *', making it free to run on any processor. _MIPS_MP_PROCESSOR_UNBIND cannot unbind exclusively bound processes. _MIPS_MP_PROCESSOR_EXUNBIND should be used for this purpose. ____MMMMIIIIPPPPSSSS____MMMMPPPP____PPPPRRRROOOOCCCCEEEESSSSSSSSOOOORRRR____EEEEXXXXBBBBIIIINNNNDDDD Exclusively bind a process number pointed to by _a_r_g_2, interpreted as 'pid_t *', to the processor number specified by _a_r_g_1, interpreted as 'int'. The process is restricted to run only on this processor. The processor may still run on other processors, briefly, to perform I/O or other hardware-specific actions. The specified processor is restricted to run only those processes that are either exclusively bound to it, or for which it must provide service due to hardware necessity, for as long as the exclusive binding is in effect. This command requires superuser authority. If a previous binding was in effect for pid, the new binding replaces the previous one. If a previous non-exclusive binding for a process other than the process number pointed to by _a_r_g_2 is in effect for this processor, it is unavailable to be reserved, and the command fails. The command returns _z_e_r_o() when successful. Possible errors from _mmmm_pppp_cccc_oooo_nnnn_ffff are: [EPERM] The effective user ID is not superuser. Many of the commands require superuser privilege. PPPPaaaaggggeeee 2222 mmmmppppccccoooonnnnffff((((3333cccc)))) mmmmppppccccoooonnnnffff((((3333cccc)))) [EPERM] The user ID of the sending process is not super-user, and its real or effective user ID does not match the real, saved, or effective user ID of the receiving process. [ESRCH] No process corresponding to that specified by a _MMMM_PPPP______MMMM_UUUU_SSSS_TTTT_RRRR_UUUU_NNNN______PPPP_IIII_DDDD, _MMMM_PPPP______GGGG_EEEE_TTTT_MMMM_UUUU_SSSS_TTTT_RRRR_UUUU_NNNN______PPPP_IIII_DDDD, or _MMMM_PPPP______RRRR_UUUU_NNNN_AAAA_NNNN_YYYY_WWWW_HHHH_EEEE_RRRR_EEEE______PPPP_IIII_DDDD could be found. [EEXIST] An attempt was made to create a new processor set, but the set already exists in the system. [EINVAL] The processor set named by a _MMMM_PPPP______PPPP_SSSS_EEEE_TTTT command does not exist. [EINVAL] The bit vector given for the _MMMM_PPPP_PPPP_SSSS______CCCC_RRRR_EEEE_AAAA_TTTT_EEEE subcommand of the _MMMM_PPPP______PPPP_SSSS_EEEE_TTTT command conflicts with a reserved value. [EBUSY] An attempt was made to delete a processor set, but the set is currently in use by the system. [EINVAL] The processor named by a _MMMM_PPPP______EEEE_MMMM_PPPP_OOOO_WWWW_EEEE_RRRR, _MMMM_PPPP______RRRR_EEEE_SSSS_TTTT_RRRR_IIII_CCCC_TTTT, _MMMM_PPPP______PPPP_SSSS_EEEE_TTTT, _MMMM_PPPP______CCCC_LLLL_OOOO_CCCC_KKKK or _MMMM_PPPP______SSSS_AAAA_GGGG_EEEE_TTTT_1111 command does not exist. [EINVAL] The _c_m_d argument is invalid. [EINVAL] The _a_r_g_1 argument to a _MMMM_PPPP______KKKK_EEEE_RRRR_NNNN_AAAA_DDDD_DDDD_RRRR command is invalid. [EINVAL] An attempt was made via _MMMM_PPPP______MMMM_UUUU_SSSS_TTTT_RRRR_UUUU_NNNN or _MMMM_PPPP______MMMM_UUUU_SSSS_TTTT_RRRR_UUUU_NNNN______PPPP_IIII_DDDD to move a process owning a CC sync register from the cpu controlling the CC sync register. [EINVAL] The target of the _MMMM_PPPP______GGGG_EEEE_TTTT_MMMM_UUUU_SSSS_TTTT_RRRR_UUUU_NNNN command has not been set to run on a specific processor. [EBUSY] An attempt was made to restrict the only unrestricted processor or to restrict the master processor. [EFAULT] An invalid buffer address has been supplied by the calling process. PPPPaaaaggggeeee 3333 mmmmppppccccoooonnnnffff((((3333cccc)))) mmmmppppccccoooonnnnffff((((3333cccc)))) [ENOMEM] Unable to obtain enough dynamic memory. SSSSEEEEEEEE AAAALLLLSSSSOOOO _ssss_yyyy_ssss_mmmm_pppp(2) DDDDIIIIAAAAGGGGNNNNOOOOSSSSTTTTIIIICCCCSSSS Upon successful completion, the _c_m_d dependent data is returned. Otherwise, a value of -1 is returned and _e_r_r_n_o is set to indicate the error. PPPPaaaaggggeeee 4444 
